ID: 988218942

View in Genome Browser
Species Human (GRCh38)
Location 5:28316551-28316573
Sequence TTACAACGTTTCTTAATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988218937_988218942 4 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218942 5:28316551-28316573 TTACAACGTTTCTTAATAGTGGG No data
988218935_988218942 27 Left 988218935 5:28316501-28316523 CCTAACAGAGATATACACGGCAT No data
Right 988218942 5:28316551-28316573 TTACAACGTTTCTTAATAGTGGG No data
988218938_988218942 3 Left 988218938 5:28316525-28316547 CCAAATCTAGAGAGGCCCACAGA No data
Right 988218942 5:28316551-28316573 TTACAACGTTTCTTAATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988218942 Original CRISPR TTACAACGTTTCTTAATAGT GGG Intergenic
No off target data available for this crispr