ID: 988218943

View in Genome Browser
Species Human (GRCh38)
Location 5:28316554-28316576
Sequence CAACGTTTCTTAATAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988218940_988218943 -10 Left 988218940 5:28316541-28316563 CCACAGATTGTTACAACGTTTCT No data
Right 988218943 5:28316554-28316576 CAACGTTTCTTAATAGTGGGAGG No data
988218939_988218943 -9 Left 988218939 5:28316540-28316562 CCCACAGATTGTTACAACGTTTC No data
Right 988218943 5:28316554-28316576 CAACGTTTCTTAATAGTGGGAGG No data
988218935_988218943 30 Left 988218935 5:28316501-28316523 CCTAACAGAGATATACACGGCAT No data
Right 988218943 5:28316554-28316576 CAACGTTTCTTAATAGTGGGAGG No data
988218938_988218943 6 Left 988218938 5:28316525-28316547 CCAAATCTAGAGAGGCCCACAGA No data
Right 988218943 5:28316554-28316576 CAACGTTTCTTAATAGTGGGAGG No data
988218937_988218943 7 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218943 5:28316554-28316576 CAACGTTTCTTAATAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988218943 Original CRISPR CAACGTTTCTTAATAGTGGG AGG Intergenic
No off target data available for this crispr