ID: 988218945

View in Genome Browser
Species Human (GRCh38)
Location 5:28316556-28316578
Sequence ACGTTTCTTAATAGTGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988218939_988218945 -7 Left 988218939 5:28316540-28316562 CCCACAGATTGTTACAACGTTTC No data
Right 988218945 5:28316556-28316578 ACGTTTCTTAATAGTGGGAGGGG No data
988218937_988218945 9 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218945 5:28316556-28316578 ACGTTTCTTAATAGTGGGAGGGG No data
988218938_988218945 8 Left 988218938 5:28316525-28316547 CCAAATCTAGAGAGGCCCACAGA No data
Right 988218945 5:28316556-28316578 ACGTTTCTTAATAGTGGGAGGGG No data
988218940_988218945 -8 Left 988218940 5:28316541-28316563 CCACAGATTGTTACAACGTTTCT No data
Right 988218945 5:28316556-28316578 ACGTTTCTTAATAGTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988218945 Original CRISPR ACGTTTCTTAATAGTGGGAG GGG Intergenic
No off target data available for this crispr