ID: 988219028

View in Genome Browser
Species Human (GRCh38)
Location 5:28317338-28317360
Sequence GAGTGAGAACATATGGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988219021_988219028 21 Left 988219021 5:28317294-28317316 CCCTCCTTGTGTCCATGTGTTCT 0: 262
1: 6123
2: 18012
3: 18911
4: 9204
Right 988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG No data
988219022_988219028 20 Left 988219022 5:28317295-28317317 CCTCCTTGTGTCCATGTGTTCTC 0: 251
1: 6190
2: 18994
3: 16905
4: 6228
Right 988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG No data
988219023_988219028 17 Left 988219023 5:28317298-28317320 CCTTGTGTCCATGTGTTCTCATT 0: 5602
1: 7567
2: 4903
3: 2277
4: 1416
Right 988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG No data
988219020_988219028 22 Left 988219020 5:28317293-28317315 CCCCTCCTTGTGTCCATGTGTTC 0: 234
1: 5621
2: 16942
3: 17675
4: 8763
Right 988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG No data
988219024_988219028 9 Left 988219024 5:28317306-28317328 CCATGTGTTCTCATTGTTCGACT 0: 86
1: 4883
2: 15371
3: 16748
4: 7947
Right 988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988219028 Original CRISPR GAGTGAGAACATATGGCACT TGG Intergenic
No off target data available for this crispr