ID: 988219227

View in Genome Browser
Species Human (GRCh38)
Location 5:28319844-28319866
Sequence ATGCTAACCTACAATTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988219224_988219227 11 Left 988219224 5:28319810-28319832 CCTTCTGAGTCTTGCAGAATGCT No data
Right 988219227 5:28319844-28319866 ATGCTAACCTACAATTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988219227 Original CRISPR ATGCTAACCTACAATTATAT AGG Intergenic
No off target data available for this crispr