ID: 988228766

View in Genome Browser
Species Human (GRCh38)
Location 5:28448097-28448119
Sequence ATTTATCTGCAGAAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988228766_988228769 15 Left 988228766 5:28448097-28448119 CCTACCATCTTCTGCAGATAAAT No data
Right 988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG No data
988228766_988228770 16 Left 988228766 5:28448097-28448119 CCTACCATCTTCTGCAGATAAAT No data
Right 988228770 5:28448136-28448158 ACAGCTCATGGCCTGTTACTGGG No data
988228766_988228768 4 Left 988228766 5:28448097-28448119 CCTACCATCTTCTGCAGATAAAT No data
Right 988228768 5:28448124-28448146 TCATTTCAAGAGACAGCTCATGG No data
988228766_988228771 22 Left 988228766 5:28448097-28448119 CCTACCATCTTCTGCAGATAAAT No data
Right 988228771 5:28448142-28448164 CATGGCCTGTTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988228766 Original CRISPR ATTTATCTGCAGAAGATGGT AGG (reversed) Intergenic
No off target data available for this crispr