ID: 988228769

View in Genome Browser
Species Human (GRCh38)
Location 5:28448135-28448157
Sequence GACAGCTCATGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988228766_988228769 15 Left 988228766 5:28448097-28448119 CCTACCATCTTCTGCAGATAAAT No data
Right 988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG No data
988228765_988228769 16 Left 988228765 5:28448096-28448118 CCCTACCATCTTCTGCAGATAAA No data
Right 988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG No data
988228767_988228769 11 Left 988228767 5:28448101-28448123 CCATCTTCTGCAGATAAATACTT No data
Right 988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988228769 Original CRISPR GACAGCTCATGGCCTGTTAC TGG Intergenic
No off target data available for this crispr