ID: 988231765

View in Genome Browser
Species Human (GRCh38)
Location 5:28488710-28488732
Sequence TCACCTCTCAAGTGTAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988231765_988231767 -3 Left 988231765 5:28488710-28488732 CCCTCTTTACACTTGAGAGGTGA No data
Right 988231767 5:28488730-28488752 TGAGCACATTCAGTGTGTTTAGG No data
988231765_988231768 22 Left 988231765 5:28488710-28488732 CCCTCTTTACACTTGAGAGGTGA No data
Right 988231768 5:28488755-28488777 GTTGTATGCATGCCCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988231765 Original CRISPR TCACCTCTCAAGTGTAAAGA GGG (reversed) Intergenic
No off target data available for this crispr