ID: 988234952

View in Genome Browser
Species Human (GRCh38)
Location 5:28530264-28530286
Sequence CTGACCTTATGTAATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988234952_988234954 29 Left 988234952 5:28530264-28530286 CCTACTTTATTACATAAGGTCAG No data
Right 988234954 5:28530316-28530338 TCACAAGAAAAAAGAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988234952 Original CRISPR CTGACCTTATGTAATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr