ID: 988246748

View in Genome Browser
Species Human (GRCh38)
Location 5:28694202-28694224
Sequence AAGAAGTAGCTGAAAGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988246746_988246748 -4 Left 988246746 5:28694183-28694205 CCCTGCTACTAGGGCATATAAGA No data
Right 988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG No data
988246747_988246748 -5 Left 988246747 5:28694184-28694206 CCTGCTACTAGGGCATATAAGAA No data
Right 988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988246748 Original CRISPR AAGAAGTAGCTGAAAGAATA TGG Intergenic
No off target data available for this crispr