ID: 988248798

View in Genome Browser
Species Human (GRCh38)
Location 5:28726699-28726721
Sequence CTACATTTGAAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988248798_988248801 11 Left 988248798 5:28726699-28726721 CCTTCCTGCTTCTTCAAATGTAG No data
Right 988248801 5:28726733-28726755 CATGTTCCAACAGTTATGTAAGG No data
988248798_988248803 17 Left 988248798 5:28726699-28726721 CCTTCCTGCTTCTTCAAATGTAG No data
Right 988248803 5:28726739-28726761 CCAACAGTTATGTAAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988248798 Original CRISPR CTACATTTGAAGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr