ID: 988255178

View in Genome Browser
Species Human (GRCh38)
Location 5:28810225-28810247
Sequence CAGGACAAAGAGAAGGCGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988255172_988255178 4 Left 988255172 5:28810198-28810220 CCGGACATAGCTTTGCAGTCCAT No data
Right 988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG No data
988255171_988255178 7 Left 988255171 5:28810195-28810217 CCGCCGGACATAGCTTTGCAGTC No data
Right 988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG No data
988255170_988255178 12 Left 988255170 5:28810190-28810212 CCACACCGCCGGACATAGCTTTG No data
Right 988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG No data
988255168_988255178 30 Left 988255168 5:28810172-28810194 CCTTTTACTGAGTTTCGTCCACA No data
Right 988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988255178 Original CRISPR CAGGACAAAGAGAAGGCGTC GGG Intergenic
No off target data available for this crispr