ID: 988255217

View in Genome Browser
Species Human (GRCh38)
Location 5:28810383-28810405
Sequence CAGCGGGCACAGGACGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988255217_988255226 -4 Left 988255217 5:28810383-28810405 CCCCTGCCGTCCTGTGCCCGCTG No data
Right 988255226 5:28810402-28810424 GCTGCGTACCCGGCAGTCTTGGG No data
988255217_988255225 -5 Left 988255217 5:28810383-28810405 CCCCTGCCGTCCTGTGCCCGCTG No data
Right 988255225 5:28810401-28810423 CGCTGCGTACCCGGCAGTCTTGG No data
988255217_988255232 28 Left 988255217 5:28810383-28810405 CCCCTGCCGTCCTGTGCCCGCTG No data
Right 988255232 5:28810434-28810456 TCAGAAGAGTCTACGGCTTCTGG No data
988255217_988255231 21 Left 988255217 5:28810383-28810405 CCCCTGCCGTCCTGTGCCCGCTG No data
Right 988255231 5:28810427-28810449 CCACAGTTCAGAAGAGTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988255217 Original CRISPR CAGCGGGCACAGGACGGCAG GGG (reversed) Intergenic
No off target data available for this crispr