ID: 988258129

View in Genome Browser
Species Human (GRCh38)
Location 5:28848119-28848141
Sequence GCGTCCTAGAAACTTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988258129_988258133 20 Left 988258129 5:28848119-28848141 CCTCAGTGAAGTTTCTAGGACGC No data
Right 988258133 5:28848162-28848184 AAATATTCTTTCTAAACTGAAGG No data
988258129_988258132 -10 Left 988258129 5:28848119-28848141 CCTCAGTGAAGTTTCTAGGACGC No data
Right 988258132 5:28848132-28848154 TCTAGGACGCTACTGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988258129 Original CRISPR GCGTCCTAGAAACTTCACTG AGG (reversed) Intergenic
No off target data available for this crispr