ID: 988264139

View in Genome Browser
Species Human (GRCh38)
Location 5:28928146-28928168
Sequence CCGGGCATGGGCTTTGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988264139_988264157 27 Left 988264139 5:28928146-28928168 CCCGGGCCAAAGCCCATGCCCGG No data
Right 988264157 5:28928196-28928218 CCGCGGCCGGGCTGGCCCCGGGG No data
988264139_988264153 19 Left 988264139 5:28928146-28928168 CCCGGGCCAAAGCCCATGCCCGG No data
Right 988264153 5:28928188-28928210 CTGACTTGCCGCGGCCGGGCTGG No data
988264139_988264150 14 Left 988264139 5:28928146-28928168 CCCGGGCCAAAGCCCATGCCCGG No data
Right 988264150 5:28928183-28928205 ACTGCCTGACTTGCCGCGGCCGG No data
988264139_988264155 26 Left 988264139 5:28928146-28928168 CCCGGGCCAAAGCCCATGCCCGG No data
Right 988264155 5:28928195-28928217 GCCGCGGCCGGGCTGGCCCCGGG No data
988264139_988264151 15 Left 988264139 5:28928146-28928168 CCCGGGCCAAAGCCCATGCCCGG No data
Right 988264151 5:28928184-28928206 CTGCCTGACTTGCCGCGGCCGGG No data
988264139_988264154 25 Left 988264139 5:28928146-28928168 CCCGGGCCAAAGCCCATGCCCGG No data
Right 988264154 5:28928194-28928216 TGCCGCGGCCGGGCTGGCCCCGG No data
988264139_988264149 10 Left 988264139 5:28928146-28928168 CCCGGGCCAAAGCCCATGCCCGG No data
Right 988264149 5:28928179-28928201 GCAGACTGCCTGACTTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988264139 Original CRISPR CCGGGCATGGGCTTTGGCCC GGG (reversed) Intergenic