ID: 988265427

View in Genome Browser
Species Human (GRCh38)
Location 5:28942666-28942688
Sequence TGGGAGAGCACAGTTATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988265427_988265439 27 Left 988265427 5:28942666-28942688 CCCACAATAACTGTGCTCTCCCA No data
Right 988265439 5:28942716-28942738 TGCCACATGGCCACTGCAAAGGG No data
988265427_988265436 14 Left 988265427 5:28942666-28942688 CCCACAATAACTGTGCTCTCCCA No data
Right 988265436 5:28942703-28942725 GATTTTCTCTCCATGCCACATGG No data
988265427_988265438 26 Left 988265427 5:28942666-28942688 CCCACAATAACTGTGCTCTCCCA No data
Right 988265438 5:28942715-28942737 ATGCCACATGGCCACTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988265427 Original CRISPR TGGGAGAGCACAGTTATTGT GGG (reversed) Intergenic
No off target data available for this crispr