ID: 988270233

View in Genome Browser
Species Human (GRCh38)
Location 5:29004523-29004545
Sequence TAGATTCTGGGGGGCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988270233_988270246 16 Left 988270233 5:29004523-29004545 CCACCCCTGCCCCCCAGAATCTA No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270233_988270245 0 Left 988270233 5:29004523-29004545 CCACCCCTGCCCCCCAGAATCTA No data
Right 988270245 5:29004546-29004568 CCAGCTTGTGGTAGAAAGATGGG No data
988270233_988270243 -1 Left 988270233 5:29004523-29004545 CCACCCCTGCCCCCCAGAATCTA No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988270233 Original CRISPR TAGATTCTGGGGGGCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr