ID: 988270243

View in Genome Browser
Species Human (GRCh38)
Location 5:29004545-29004567
Sequence ACCAGCTTGTGGTAGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988270234_988270243 -4 Left 988270234 5:29004526-29004548 CCCCTGCCCCCCAGAATCTACCA No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270236_988270243 -6 Left 988270236 5:29004528-29004550 CCTGCCCCCCAGAATCTACCAGC No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270235_988270243 -5 Left 988270235 5:29004527-29004549 CCCTGCCCCCCAGAATCTACCAG No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270229_988270243 9 Left 988270229 5:29004513-29004535 CCACCCCACACCACCCCTGCCCC No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270237_988270243 -10 Left 988270237 5:29004532-29004554 CCCCCCAGAATCTACCAGCTTGT No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270233_988270243 -1 Left 988270233 5:29004523-29004545 CCACCCCTGCCCCCCAGAATCTA No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270227_988270243 22 Left 988270227 5:29004500-29004522 CCTCTCTCATCTCCCACCCCACA No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270228_988270243 10 Left 988270228 5:29004512-29004534 CCCACCCCACACCACCCCTGCCC No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270231_988270243 5 Left 988270231 5:29004517-29004539 CCCACACCACCCCTGCCCCCCAG No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270232_988270243 4 Left 988270232 5:29004518-29004540 CCACACCACCCCTGCCCCCCAGA No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data
988270230_988270243 6 Left 988270230 5:29004516-29004538 CCCCACACCACCCCTGCCCCCCA No data
Right 988270243 5:29004545-29004567 ACCAGCTTGTGGTAGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988270243 Original CRISPR ACCAGCTTGTGGTAGAAAGA TGG Intergenic
No off target data available for this crispr