ID: 988270246

View in Genome Browser
Species Human (GRCh38)
Location 5:29004562-29004584
Sequence AGATGGGAACATGTAATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988270232_988270246 21 Left 988270232 5:29004518-29004540 CCACACCACCCCTGCCCCCCAGA No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270237_988270246 7 Left 988270237 5:29004532-29004554 CCCCCCAGAATCTACCAGCTTGT No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270228_988270246 27 Left 988270228 5:29004512-29004534 CCCACCCCACACCACCCCTGCCC No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270241_988270246 4 Left 988270241 5:29004535-29004557 CCCAGAATCTACCAGCTTGTGGT No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270234_988270246 13 Left 988270234 5:29004526-29004548 CCCCTGCCCCCCAGAATCTACCA No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270229_988270246 26 Left 988270229 5:29004513-29004535 CCACCCCACACCACCCCTGCCCC No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270230_988270246 23 Left 988270230 5:29004516-29004538 CCCCACACCACCCCTGCCCCCCA No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270244_988270246 -7 Left 988270244 5:29004546-29004568 CCAGCTTGTGGTAGAAAGATGGG No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270239_988270246 5 Left 988270239 5:29004534-29004556 CCCCAGAATCTACCAGCTTGTGG No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270242_988270246 3 Left 988270242 5:29004536-29004558 CCAGAATCTACCAGCTTGTGGTA No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270235_988270246 12 Left 988270235 5:29004527-29004549 CCCTGCCCCCCAGAATCTACCAG No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270236_988270246 11 Left 988270236 5:29004528-29004550 CCTGCCCCCCAGAATCTACCAGC No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270233_988270246 16 Left 988270233 5:29004523-29004545 CCACCCCTGCCCCCCAGAATCTA No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270231_988270246 22 Left 988270231 5:29004517-29004539 CCCACACCACCCCTGCCCCCCAG No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data
988270238_988270246 6 Left 988270238 5:29004533-29004555 CCCCCAGAATCTACCAGCTTGTG No data
Right 988270246 5:29004562-29004584 AGATGGGAACATGTAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988270246 Original CRISPR AGATGGGAACATGTAATCCA AGG Intergenic
No off target data available for this crispr