ID: 988275819

View in Genome Browser
Species Human (GRCh38)
Location 5:29080026-29080048
Sequence GTCCCCACCCCCACGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988275819_988275820 22 Left 988275819 5:29080026-29080048 CCAGCTCTCGTGGGGGTGGGGAC No data
Right 988275820 5:29080071-29080093 AGAATTCACTCATTACCTTGAGG No data
988275819_988275821 26 Left 988275819 5:29080026-29080048 CCAGCTCTCGTGGGGGTGGGGAC No data
Right 988275821 5:29080075-29080097 TTCACTCATTACCTTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988275819 Original CRISPR GTCCCCACCCCCACGAGAGC TGG (reversed) Intergenic
No off target data available for this crispr