ID: 988284512

View in Genome Browser
Species Human (GRCh38)
Location 5:29194027-29194049
Sequence CAGCAACTCCCTGTTCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988284512_988284516 22 Left 988284512 5:29194027-29194049 CCAGTATGAACAGGGAGTTGCTG No data
Right 988284516 5:29194072-29194094 TTTTGTGTGTAAGTTCGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988284512 Original CRISPR CAGCAACTCCCTGTTCATAC TGG (reversed) Intergenic
No off target data available for this crispr