ID: 988291489

View in Genome Browser
Species Human (GRCh38)
Location 5:29294302-29294324
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988291489_988291497 9 Left 988291489 5:29294302-29294324 CCCATTAGTAACCTCGAAATCCC No data
Right 988291497 5:29294334-29294356 ATCCTTTCCCTCCAGGGTGAAGG No data
988291489_988291501 18 Left 988291489 5:29294302-29294324 CCCATTAGTAACCTCGAAATCCC No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data
988291489_988291495 3 Left 988291489 5:29294302-29294324 CCCATTAGTAACCTCGAAATCCC No data
Right 988291495 5:29294328-29294350 AATCCAATCCTTTCCCTCCAGGG No data
988291489_988291494 2 Left 988291489 5:29294302-29294324 CCCATTAGTAACCTCGAAATCCC No data
Right 988291494 5:29294327-29294349 AAATCCAATCCTTTCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988291489 Original CRISPR GGGATTTCGAGGTTACTAAT GGG (reversed) Intergenic