ID: 988291491

View in Genome Browser
Species Human (GRCh38)
Location 5:29294313-29294335
Sequence ATTGGATTTTAGGGATTTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988291491_988291497 -2 Left 988291491 5:29294313-29294335 CCTCGAAATCCCTAAAATCCAAT No data
Right 988291497 5:29294334-29294356 ATCCTTTCCCTCCAGGGTGAAGG No data
988291491_988291495 -8 Left 988291491 5:29294313-29294335 CCTCGAAATCCCTAAAATCCAAT No data
Right 988291495 5:29294328-29294350 AATCCAATCCTTTCCCTCCAGGG No data
988291491_988291494 -9 Left 988291491 5:29294313-29294335 CCTCGAAATCCCTAAAATCCAAT No data
Right 988291494 5:29294327-29294349 AAATCCAATCCTTTCCCTCCAGG No data
988291491_988291501 7 Left 988291491 5:29294313-29294335 CCTCGAAATCCCTAAAATCCAAT No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988291491 Original CRISPR ATTGGATTTTAGGGATTTCG AGG (reversed) Intergenic