ID: 988291492

View in Genome Browser
Species Human (GRCh38)
Location 5:29294322-29294344
Sequence AGGGAAAGGATTGGATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988291492_988291501 -2 Left 988291492 5:29294322-29294344 CCCTAAAATCCAATCCTTTCCCT No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988291492 Original CRISPR AGGGAAAGGATTGGATTTTA GGG (reversed) Intergenic