ID: 988291493

View in Genome Browser
Species Human (GRCh38)
Location 5:29294323-29294345
Sequence GAGGGAAAGGATTGGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988291493_988291501 -3 Left 988291493 5:29294323-29294345 CCTAAAATCCAATCCTTTCCCTC No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988291493 Original CRISPR GAGGGAAAGGATTGGATTTT AGG (reversed) Intergenic
No off target data available for this crispr