ID: 988291494

View in Genome Browser
Species Human (GRCh38)
Location 5:29294327-29294349
Sequence AAATCCAATCCTTTCCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988291490_988291494 1 Left 988291490 5:29294303-29294325 CCATTAGTAACCTCGAAATCCCT No data
Right 988291494 5:29294327-29294349 AAATCCAATCCTTTCCCTCCAGG No data
988291489_988291494 2 Left 988291489 5:29294302-29294324 CCCATTAGTAACCTCGAAATCCC No data
Right 988291494 5:29294327-29294349 AAATCCAATCCTTTCCCTCCAGG No data
988291491_988291494 -9 Left 988291491 5:29294313-29294335 CCTCGAAATCCCTAAAATCCAAT No data
Right 988291494 5:29294327-29294349 AAATCCAATCCTTTCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988291494 Original CRISPR AAATCCAATCCTTTCCCTCC AGG Intergenic