ID: 988291495

View in Genome Browser
Species Human (GRCh38)
Location 5:29294328-29294350
Sequence AATCCAATCCTTTCCCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988291489_988291495 3 Left 988291489 5:29294302-29294324 CCCATTAGTAACCTCGAAATCCC No data
Right 988291495 5:29294328-29294350 AATCCAATCCTTTCCCTCCAGGG No data
988291491_988291495 -8 Left 988291491 5:29294313-29294335 CCTCGAAATCCCTAAAATCCAAT No data
Right 988291495 5:29294328-29294350 AATCCAATCCTTTCCCTCCAGGG No data
988291490_988291495 2 Left 988291490 5:29294303-29294325 CCATTAGTAACCTCGAAATCCCT No data
Right 988291495 5:29294328-29294350 AATCCAATCCTTTCCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988291495 Original CRISPR AATCCAATCCTTTCCCTCCA GGG Intergenic