ID: 988291501

View in Genome Browser
Species Human (GRCh38)
Location 5:29294343-29294365
Sequence CTCCAGGGTGAAGGTATATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988291492_988291501 -2 Left 988291492 5:29294322-29294344 CCCTAAAATCCAATCCTTTCCCT No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data
988291493_988291501 -3 Left 988291493 5:29294323-29294345 CCTAAAATCCAATCCTTTCCCTC No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data
988291491_988291501 7 Left 988291491 5:29294313-29294335 CCTCGAAATCCCTAAAATCCAAT No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data
988291489_988291501 18 Left 988291489 5:29294302-29294324 CCCATTAGTAACCTCGAAATCCC No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data
988291490_988291501 17 Left 988291490 5:29294303-29294325 CCATTAGTAACCTCGAAATCCCT No data
Right 988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988291501 Original CRISPR CTCCAGGGTGAAGGTATATT AGG Intergenic
No off target data available for this crispr