ID: 988294074

View in Genome Browser
Species Human (GRCh38)
Location 5:29331951-29331973
Sequence CAGGAAAAGCTGGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988294069_988294074 -10 Left 988294069 5:29331938-29331960 CCATGGCCAAGGGCAGGAAAAGC No data
Right 988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG No data
988294065_988294074 3 Left 988294065 5:29331925-29331947 CCATTGACAGTCACCATGGCCAA No data
Right 988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG No data
988294063_988294074 9 Left 988294063 5:29331919-29331941 CCTGAGCCATTGACAGTCACCAT No data
Right 988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988294074 Original CRISPR CAGGAAAAGCTGGAGGAGGA TGG Intergenic
No off target data available for this crispr