ID: 988294428

View in Genome Browser
Species Human (GRCh38)
Location 5:29336499-29336521
Sequence TGTTATAAAAGATCAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988294424_988294428 20 Left 988294424 5:29336456-29336478 CCTCCTGTTTATTAGAATTCAGA No data
Right 988294428 5:29336499-29336521 TGTTATAAAAGATCAGATAAAGG No data
988294425_988294428 17 Left 988294425 5:29336459-29336481 CCTGTTTATTAGAATTCAGAAAT No data
Right 988294428 5:29336499-29336521 TGTTATAAAAGATCAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988294428 Original CRISPR TGTTATAAAAGATCAGATAA AGG Intergenic
No off target data available for this crispr