ID: 988297660

View in Genome Browser
Species Human (GRCh38)
Location 5:29387258-29387280
Sequence TGACACCAGGTATGTTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988297660_988297665 11 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297665 5:29387292-29387314 AGGATGCAGCTGGAAAAATGTGG No data
988297660_988297664 1 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297664 5:29387282-29387304 GAGTGATTCAAGGATGCAGCTGG No data
988297660_988297667 18 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297667 5:29387299-29387321 AGCTGGAAAAATGTGGATTTGGG No data
988297660_988297663 -9 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297663 5:29387272-29387294 CTGGTGTCAGGAGTGATTCAAGG No data
988297660_988297666 17 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297666 5:29387298-29387320 CAGCTGGAAAAATGTGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988297660 Original CRISPR TGACACCAGGTATGTTAAGT TGG (reversed) Intergenic
No off target data available for this crispr