ID: 988297663

View in Genome Browser
Species Human (GRCh38)
Location 5:29387272-29387294
Sequence CTGGTGTCAGGAGTGATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988297658_988297663 -1 Left 988297658 5:29387250-29387272 CCAGATAGCCAACTTAACATACC No data
Right 988297663 5:29387272-29387294 CTGGTGTCAGGAGTGATTCAAGG No data
988297660_988297663 -9 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297663 5:29387272-29387294 CTGGTGTCAGGAGTGATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988297663 Original CRISPR CTGGTGTCAGGAGTGATTCA AGG Intergenic
No off target data available for this crispr