ID: 988297664

View in Genome Browser
Species Human (GRCh38)
Location 5:29387282-29387304
Sequence GAGTGATTCAAGGATGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988297658_988297664 9 Left 988297658 5:29387250-29387272 CCAGATAGCCAACTTAACATACC No data
Right 988297664 5:29387282-29387304 GAGTGATTCAAGGATGCAGCTGG No data
988297660_988297664 1 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297664 5:29387282-29387304 GAGTGATTCAAGGATGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988297664 Original CRISPR GAGTGATTCAAGGATGCAGC TGG Intergenic
No off target data available for this crispr