ID: 988297665

View in Genome Browser
Species Human (GRCh38)
Location 5:29387292-29387314
Sequence AGGATGCAGCTGGAAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988297662_988297665 -2 Left 988297662 5:29387271-29387293 CCTGGTGTCAGGAGTGATTCAAG No data
Right 988297665 5:29387292-29387314 AGGATGCAGCTGGAAAAATGTGG No data
988297660_988297665 11 Left 988297660 5:29387258-29387280 CCAACTTAACATACCTGGTGTCA No data
Right 988297665 5:29387292-29387314 AGGATGCAGCTGGAAAAATGTGG No data
988297658_988297665 19 Left 988297658 5:29387250-29387272 CCAGATAGCCAACTTAACATACC No data
Right 988297665 5:29387292-29387314 AGGATGCAGCTGGAAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988297665 Original CRISPR AGGATGCAGCTGGAAAAATG TGG Intergenic
No off target data available for this crispr