ID: 988299538

View in Genome Browser
Species Human (GRCh38)
Location 5:29404316-29404338
Sequence CCCATAGCCGCCATCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988299538_988299548 15 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299548 5:29404354-29404376 CTTTGGAAAGGGAAGGTAAGAGG No data
988299538_988299543 3 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299543 5:29404342-29404364 AGGCTCCTCTGCCTTTGGAAAGG 0: 87
1: 215
2: 303
3: 293
4: 497
988299538_988299546 8 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299546 5:29404347-29404369 CCTCTGCCTTTGGAAAGGGAAGG 0: 7
1: 89
2: 251
3: 284
4: 646
988299538_988299551 18 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299551 5:29404357-29404379 TGGAAAGGGAAGGTAAGAGGGGG No data
988299538_988299549 16 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299549 5:29404355-29404377 TTTGGAAAGGGAAGGTAAGAGGG No data
988299538_988299544 4 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299544 5:29404343-29404365 GGCTCCTCTGCCTTTGGAAAGGG 0: 80
1: 239
2: 298
3: 308
4: 518
988299538_988299542 -2 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299542 5:29404337-29404359 GGGTGAGGCTCCTCTGCCTTTGG 0: 56
1: 165
2: 271
3: 326
4: 565
988299538_988299550 17 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299550 5:29404356-29404378 TTGGAAAGGGAAGGTAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988299538 Original CRISPR CCCATAGCCGCCATCAACAC AGG (reversed) Intergenic
No off target data available for this crispr