ID: 988299548

View in Genome Browser
Species Human (GRCh38)
Location 5:29404354-29404376
Sequence CTTTGGAAAGGGAAGGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988299538_988299548 15 Left 988299538 5:29404316-29404338 CCTGTGTTGATGGCGGCTATGGG No data
Right 988299548 5:29404354-29404376 CTTTGGAAAGGGAAGGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988299548 Original CRISPR CTTTGGAAAGGGAAGGTAAG AGG Intergenic
No off target data available for this crispr