ID: 988306259

View in Genome Browser
Species Human (GRCh38)
Location 5:29498457-29498479
Sequence GCTACGTGCACATGCAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988306259_988306262 26 Left 988306259 5:29498457-29498479 CCTCATTTGCATGTGCACGTAGC No data
Right 988306262 5:29498506-29498528 GCATGCTCCTAGACTGCAGCAGG No data
988306259_988306260 -4 Left 988306259 5:29498457-29498479 CCTCATTTGCATGTGCACGTAGC No data
Right 988306260 5:29498476-29498498 TAGCAGCTACAGCTGCAGCAAGG No data
988306259_988306261 2 Left 988306259 5:29498457-29498479 CCTCATTTGCATGTGCACGTAGC No data
Right 988306261 5:29498482-29498504 CTACAGCTGCAGCAAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988306259 Original CRISPR GCTACGTGCACATGCAAATG AGG (reversed) Intergenic