ID: 988306261

View in Genome Browser
Species Human (GRCh38)
Location 5:29498482-29498504
Sequence CTACAGCTGCAGCAAGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988306259_988306261 2 Left 988306259 5:29498457-29498479 CCTCATTTGCATGTGCACGTAGC No data
Right 988306261 5:29498482-29498504 CTACAGCTGCAGCAAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988306261 Original CRISPR CTACAGCTGCAGCAAGGTGT TGG Intergenic