ID: 988306651

View in Genome Browser
Species Human (GRCh38)
Location 5:29501722-29501744
Sequence GTGAGGGATAAAACCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988306651_988306656 0 Left 988306651 5:29501722-29501744 CCACTCAAGGTTTTATCCCTCAC No data
Right 988306656 5:29501745-29501767 AACATGTGGGATCTATCACTTGG No data
988306651_988306657 3 Left 988306651 5:29501722-29501744 CCACTCAAGGTTTTATCCCTCAC No data
Right 988306657 5:29501748-29501770 ATGTGGGATCTATCACTTGGTGG No data
988306651_988306658 4 Left 988306651 5:29501722-29501744 CCACTCAAGGTTTTATCCCTCAC No data
Right 988306658 5:29501749-29501771 TGTGGGATCTATCACTTGGTGGG No data
988306651_988306659 30 Left 988306651 5:29501722-29501744 CCACTCAAGGTTTTATCCCTCAC No data
Right 988306659 5:29501775-29501797 CAGTCCAATGACCACAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988306651 Original CRISPR GTGAGGGATAAAACCTTGAG TGG (reversed) Intergenic
No off target data available for this crispr