ID: 988306957

View in Genome Browser
Species Human (GRCh38)
Location 5:29505193-29505215
Sequence TAGGTGACTAAAGTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988306957_988306962 5 Left 988306957 5:29505193-29505215 CCAGCAGCAACTTTAGTCACCTA No data
Right 988306962 5:29505221-29505243 TCTGGAGCAACATCTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988306957 Original CRISPR TAGGTGACTAAAGTTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr