ID: 988307320

View in Genome Browser
Species Human (GRCh38)
Location 5:29509348-29509370
Sequence GAGAGGCATGTGCCAACTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988307320_988307325 -2 Left 988307320 5:29509348-29509370 CCCGGAGTTGGCACATGCCTCTC No data
Right 988307325 5:29509369-29509391 TCTCTCTTGTGGATCTGGAGAGG No data
988307320_988307323 -7 Left 988307320 5:29509348-29509370 CCCGGAGTTGGCACATGCCTCTC No data
Right 988307323 5:29509364-29509386 GCCTCTCTCTCTTGTGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988307320 Original CRISPR GAGAGGCATGTGCCAACTCC GGG (reversed) Intergenic
No off target data available for this crispr