ID: 988307981

View in Genome Browser
Species Human (GRCh38)
Location 5:29518430-29518452
Sequence AAGAGGTGTTATTATTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988307981_988307985 30 Left 988307981 5:29518430-29518452 CCTAAGCAATAATAACACCTCTT No data
Right 988307985 5:29518483-29518505 TACTGCCCCCAGCATTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988307981 Original CRISPR AAGAGGTGTTATTATTGCTT AGG (reversed) Intergenic
No off target data available for this crispr