ID: 988307984

View in Genome Browser
Species Human (GRCh38)
Location 5:29518457-29518479
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988307984_988307985 3 Left 988307984 5:29518457-29518479 CCAAGAACAAGTTGTTTATATAT No data
Right 988307985 5:29518483-29518505 TACTGCCCCCAGCATTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988307984 Original CRISPR ATATATAAACAACTTGTTCT TGG (reversed) Intergenic
No off target data available for this crispr