ID: 988310984

View in Genome Browser
Species Human (GRCh38)
Location 5:29556777-29556799
Sequence CAGAAGATGTGGCTGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988310979_988310984 11 Left 988310979 5:29556743-29556765 CCTCTGTGGGCAATGTTCCTTTT No data
Right 988310984 5:29556777-29556799 CAGAAGATGTGGCTGTTCTCTGG No data
988310978_988310984 17 Left 988310978 5:29556737-29556759 CCATTTCCTCTGTGGGCAATGTT No data
Right 988310984 5:29556777-29556799 CAGAAGATGTGGCTGTTCTCTGG No data
988310980_988310984 -6 Left 988310980 5:29556760-29556782 CCTTTTTGACTCATGCCCAGAAG No data
Right 988310984 5:29556777-29556799 CAGAAGATGTGGCTGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988310984 Original CRISPR CAGAAGATGTGGCTGTTCTC TGG Intergenic
No off target data available for this crispr