ID: 988324260

View in Genome Browser
Species Human (GRCh38)
Location 5:29741526-29741548
Sequence TCCTTGCTCCAGTTTCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988324260_988324267 28 Left 988324260 5:29741526-29741548 CCCCTTGGAAACTGGAGCAAGGA No data
Right 988324267 5:29741577-29741599 CAAAATCTTTTTGAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988324260 Original CRISPR TCCTTGCTCCAGTTTCCAAG GGG (reversed) Intergenic