ID: 988328700

View in Genome Browser
Species Human (GRCh38)
Location 5:29806193-29806215
Sequence TATTTCTTGTTGAAGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988328700_988328704 25 Left 988328700 5:29806193-29806215 CCTTCAGACTTCAACAAGAAATA No data
Right 988328704 5:29806241-29806263 GCTTGCCAATTGTAAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988328700 Original CRISPR TATTTCTTGTTGAAGTCTGA AGG (reversed) Intergenic
No off target data available for this crispr