ID: 988328704

View in Genome Browser
Species Human (GRCh38)
Location 5:29806241-29806263
Sequence GCTTGCCAATTGTAAATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988328700_988328704 25 Left 988328700 5:29806193-29806215 CCTTCAGACTTCAACAAGAAATA No data
Right 988328704 5:29806241-29806263 GCTTGCCAATTGTAAATCTCAGG No data
988328702_988328704 0 Left 988328702 5:29806218-29806240 CCATTGGTTATTCTGAGCCTCTA No data
Right 988328704 5:29806241-29806263 GCTTGCCAATTGTAAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988328704 Original CRISPR GCTTGCCAATTGTAAATCTC AGG Intergenic
No off target data available for this crispr