ID: 988330847

View in Genome Browser
Species Human (GRCh38)
Location 5:29837829-29837851
Sequence TAACCATATGAAAACAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988330847_988330852 19 Left 988330847 5:29837829-29837851 CCATATTTGTTTTCATATGGTTA No data
Right 988330852 5:29837871-29837893 CACCTTAATGGTTTTATTTCGGG No data
988330847_988330849 7 Left 988330847 5:29837829-29837851 CCATATTTGTTTTCATATGGTTA No data
Right 988330849 5:29837859-29837881 AGAACAACAATCCACCTTAATGG No data
988330847_988330851 18 Left 988330847 5:29837829-29837851 CCATATTTGTTTTCATATGGTTA No data
Right 988330851 5:29837870-29837892 CCACCTTAATGGTTTTATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988330847 Original CRISPR TAACCATATGAAAACAAATA TGG (reversed) Intergenic
No off target data available for this crispr