ID: 988330849

View in Genome Browser
Species Human (GRCh38)
Location 5:29837859-29837881
Sequence AGAACAACAATCCACCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988330847_988330849 7 Left 988330847 5:29837829-29837851 CCATATTTGTTTTCATATGGTTA No data
Right 988330849 5:29837859-29837881 AGAACAACAATCCACCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988330849 Original CRISPR AGAACAACAATCCACCTTAA TGG Intergenic
No off target data available for this crispr