ID: 988336894

View in Genome Browser
Species Human (GRCh38)
Location 5:29919526-29919548
Sequence ATGTCCTTACAGCTGAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988336894_988336901 25 Left 988336894 5:29919526-29919548 CCCTACCTCAGCTGTAAGGACAT No data
Right 988336901 5:29919574-29919596 TACTAAGGCTAAAGAGTCTATGG No data
988336894_988336900 10 Left 988336894 5:29919526-29919548 CCCTACCTCAGCTGTAAGGACAT No data
Right 988336900 5:29919559-29919581 TCTACTCTGTGATACTACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988336894 Original CRISPR ATGTCCTTACAGCTGAGGTA GGG (reversed) Intergenic
No off target data available for this crispr